Display Settings:

Format

Send to:

Choose Destination
Pr012845614

STS probe D8S470 for vacuolar protein sorting 13 homolog B (VPS13B)

Synopsis

Field NameValues
NameD8S470
AliasesHUMUT5392; RH34253; SHGC-5238; UT5392
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneVPS13B
UniSTS IDUniSTS:9622

Sequences

>Probe|12845614|PRIMERF Forward PCR primer (outermost) (24b)
ACGACTGTACTTTGGCTTGGGTAA
>Probe|12845614|PRIMERR Reverse PCR primer (outermost) (25b)
CCTCTTCTGTTATTTCTCCCTCACT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G383607 cr10000SHGC-5238
Homo sapienslinkageRutgers Map8 cmD8S470
Homo sapiensradiation hybridNCBI RH81127.8 crSHGC-5238

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID9622
Probe Cross-refcontext specific help for: Probe Cross-refGDB:198706
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center