Display Settings:

Format

Send to:

Choose Destination
Pr012844475

STS probe G44720 for pyruvate dehydrogenase (lipoamide) beta (PDHB) and 2 more genes

Synopsis

Field NameValues
NameG44720
Alias825
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPDHB; PDHB; PDHB
UniSTS IDUniSTS:95195

Sequences

>Probe|12844475|PRIMERF Forward PCR primer (outermost) (20b)
TGCACCTGGATTTGTACTGC
>Probe|12844475|PRIMERR Reverse PCR primer (outermost) (20b)
GGGGAGGAGAGTGGAGAGTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmG44720

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID95195
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center