Display Settings:

Format

Send to:

Choose Destination
Pr012844428

STS probe G44366 for long-wave-sensitive opsin 1 (LOC699016) and 4 more genes

Synopsis

Field NameValues
NameG44366
AliasWIAF-4135-STS
TypeSTS
Application
Source organism
Source sequence
Target genesOPN1LW; LOC100445186; LOC100595592; LOC699016; OPN1LW
UniSTS IDUniSTS:95152

Sequences

>Probe|12844428|PRIMERF Forward PCR primer (outermost) (20b)
ACAGGTCTCTGGTCTCTGGC
>Probe|12844428|PRIMERR Reverse PCR primer (outermost) (20b)
AATCTCACATTGCCAAAGGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID95152
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center