Display Settings:

Format

Send to:

Choose Destination
Pr012843883

STS probe AL035148 for uncharacterized LOC100446831 (LOC100446831)

Synopsis

Field NameValues
NameAL035148
AliasstdJ874H6SP6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC100446831
UniSTS IDUniSTS:94661

Sequences

>Probe|12843883|PRIMERF Forward PCR primer (outermost) (20b)
TTCTCCCCTTCCATTCCTCT
>Probe|12843883|PRIMERR Reverse PCR primer (outermost) (22b)
CCAGGAAGTCTGGAAAATATGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL035148

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID94661
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center