Display Settings:

Format

Send to:

Choose Destination
Pr012843878

STS probe AL035127 for PHD finger protein 6 (PHF6) and 1 more gene

Synopsis

Field NameValues
NameAL035127
AliasstdJ71G4SP6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC26A3; PHF6
UniSTS IDUniSTS:94657

Sequences

>Probe|12843878|PRIMERF Forward PCR primer (outermost) (20b)
TCTCATGGTTGTGGGGTTTT
>Probe|12843878|PRIMERR Reverse PCR primer (outermost) (20b)
TCCCACCTGAATCACTCTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL035127

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID94657
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center