Display Settings:

Format

Send to:

Choose Destination
Pr012841800

STS probe RH15607 for 14-3-3 protein theta (LOC704010) and 3 more genes

Synopsis

Field NameValues
NameRH15607
AliasstSG1949
TypeSTS
Application
Source organism
Source sequence
Target genesYWHAQ; LOC100440890; YWHAQ; LOC704010
UniSTS IDUniSTS:92785

Sequences

>Probe|12841800|PRIMERF Forward PCR primer (outermost) (22b)
TTTATACACTTCCAGGCATCCC
>Probe|12841800|PRIMERR Reverse PCR primer (outermost) (22b)
GCTTTGTAACAATTGCATACCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID92785
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center