Display Settings:

Format

Send to:

Choose Destination
Pr012840417

STS probe RH45478 for BTG anti-proliferation factor 3 (BTG3) and 13 more genes

Synopsis

Field NameValues
NameRH45478
AliasstSG16294
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesBTG3; BTG3; BTG3; BTG3; BTG3; BTG3; LOC100519568; BTG3; BTG3; BTG3; CXADR; BTG3; BTG3; BTG3
UniSTS IDUniSTS:91534

Sequences

>Probe|12840417|PRIMERF Forward PCR primer (outermost) (22b)
TGCAACTACATGATTTCACACA
>Probe|12840417|PRIMERR Reverse PCR primer (outermost) (22b)
TGCATCAACTCTGTTGGATACG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map21 cmRH45478

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID91534
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center