Display Settings:

Format

Send to:

Choose Destination
Pr012839516

STS probe D22S410E for septin 3 (SEPT3) and 9 more genes

Synopsis

Field NameValues
NameD22S410E
AliasesRH27815; stSG5873
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSEPT3; LOC100425253; LOC100457441; SEPT3; WBP2NL; WBP2NL; SEPT3; WBP2NL; SEPT3; SEPT3
UniSTS IDUniSTS:90720

Sequences

>Probe|12839516|PRIMERF Forward PCR primer (outermost) (18b)
TCACCGTAAGATTGGCTG
>Probe|12839516|PRIMERR Reverse PCR primer (outermost) (20b)
AAGTCCTGATGGAGCAAGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S410E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID90720
Probe Cross-refcontext specific help for: Probe Cross-refGDB:198933
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center