Display Settings:

Format

Send to:

Choose Destination
Pr012837375

STS probe RH93724 for tau tubulin kinase 2 (TTBK2) and 3 more genes

Synopsis

Field NameValues
NameRH93724
AliasstSG50567
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTTBK2; TTBK2; TTBK2; TTBK2
UniSTS IDUniSTS:88789

Sequences

>Probe|12837375|PRIMERF Forward PCR primer (outermost) (20b)
GCAAATTTCAACAGCAAGCA
>Probe|12837375|PRIMERR Reverse PCR primer (outermost) (22b)
TCAGGCAAATGAAAGTCTACCA

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415155.03 cr3000stSG50567
Homo sapienslinkageRutgers Map15 cmRH93724

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID88789
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center