Display Settings:

Format

Send to:

Choose Destination
Pr012837238

STS probe RH40514 for signal transducer and activator of transcription 2 (STAT2) and 8 more genes

Synopsis

Field NameValues
NameRH40514
TypeSTS
Application
Source organism
Source sequence
Target genesVPS37A; STAT2; STAT2; VPS37A; VPS37A; STAT2; VPS37A; STAT2; VPS37A
UniSTS IDUniSTS:88665

Sequences

>Probe|12837238|PRIMERF Forward PCR primer (outermost) (23b)
GATCAGCACAAAGTTTATTAGCC
>Probe|12837238|PRIMERR Reverse PCR primer (outermost) (21b)
AGGTCTGTCATAGGACTCTGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID88665
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center