Display Settings:

Format

Send to:

Choose Destination
Pr012835615

STS probe RH76001 for hepatocyte nuclear factor 4 alpha (HNF4A) and 2 more genes

Synopsis

Field NameValues
NameRH76001
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHNF4A; HNF4A; HNF4A
UniSTS IDUniSTS:87196

Sequences

>Probe|12835615|PRIMERF Forward PCR primer (outermost) (20b)
CCCAGTCCCCCTAAGAGAGC
>Probe|12835615|PRIMERR Reverse PCR primer (outermost) (21b)
GGATGAAGGTGAAGGTGAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmRH76001

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID87196
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center