Display Settings:

Format

Send to:

Choose Destination
Pr012835459

STS probe RH80278 for immunoglobulin heavy locus (IGH) and 2 more genes

Synopsis

Field NameValues
NameRH80278
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100294423; IGH; LOC651286
UniSTS IDUniSTS:87055

Sequences

>Probe|12835459|PRIMERF Forward PCR primer (outermost) (20b)
CCAGCTTTTTCTCTGCCAGC
>Probe|12835459|PRIMERR Reverse PCR primer (outermost) (21b)
TCTGTTGAAGGGACAGACACG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID87055
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center