Display Settings:

Format

Send to:

Choose Destination
Pr012834612

STS probe RH39444 for small nuclear ribonucleoprotein polypeptide N (SNRPN) and 5 more genes

Synopsis

Field NameValues
NameRH39444
TypeSTS
Application
Source organism
Source sequence
Target genesDMAC1; LOC100591840; SNRPN; DMAC1; DMAC1; DMAC1
UniSTS IDUniSTS:86290

Sequences

>Probe|12834612|PRIMERF Forward PCR primer (outermost) (21b)
CAAGTTCTAGCTCCATCACGG
>Probe|12834612|PRIMERR Reverse PCR primer (outermost) (20b)
GCAAAGGCATTTTCAAATCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID86290
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center