Display Settings:

Format

Send to:

Choose Destination
Pr012833087

STS probe RH70850 for ATP synthase, H+ transporting, mitochondrial Fo complex subunit B1 (ATP5F1) and 5 more genes

Synopsis

Field NameValues
NameRH70850
TypeSTS
Application
Source organism
Source sequence
Target genesATP5F1; ATP5F1; ATP5F1; LOC653322; LOC653892; LOC701105
UniSTS IDUniSTS:84910

Sequences

>Probe|12833087|PRIMERF Forward PCR primer (outermost) (20b)
AGAACGAAATCTCTATCGGC
>Probe|12833087|PRIMERR Reverse PCR primer (outermost) (21b)
ATCTTTAGTCAGGCAGCAAGT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID84910
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center