Display Settings:

Format

Send to:

Choose Destination
Pr012832813

STS probe RH15603 for eukaryotic translation elongation factor 1 gamma (Eef1g) and 11 more genes

Synopsis

Field NameValues
NameRH15603
AliasstSG1414
TypeSTS
Application
Source organism
Source sequence
Target genesEEF1G; LOC100157633; LOC100523878; LOC100585901; EEF1G; AHNAK; EEF1G; LOC100754680; Eef1g; EEF1G; LOC614887; LOC782525
UniSTS IDUniSTS:84660

Sequences

>Probe|12832813|PRIMERF Forward PCR primer (outermost) (18b)
ACCCCCATCTCCCTGAAG
>Probe|12832813|PRIMERR Reverse PCR primer (outermost) (20b)
CATACACATGGCGGAAACTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5500703
UniSTS IDcontext specific help for: UniSTS ID84660
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center