Display Settings:

Format

Send to:

Choose Destination
Pr012832215

STS probe RH27840 for histone cell cycle regulator (HIRA) and 7 more genes

Synopsis

Field NameValues
NameRH27840
AliasesTUPLE1; stSG5921
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100346533; LOC100407742; LOC100410150; LOC100450459; LOC100581135; HIRA; HIRA; HIRA
UniSTS IDUniSTS:84120

Sequences

>Probe|12832215|PRIMERF Forward PCR primer (outermost) (21b)
AAGGAAAGCTGTTCCAACACA
>Probe|12832215|PRIMERR Reverse PCR primer (outermost) (22b)
ACAAGTGACCAATGTCCAAGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmRH27840

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID84120
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center