Display Settings:

Format

Send to:

Choose Destination
Pr012831544

STS probe D7S672 for calneuron 1 (CALN1) and 1 more gene

Synopsis

Field NameValues
NameD7S672
AliasesAFM289ve9; sWSS1212
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCALN1; CALN1
UniSTS IDUniSTS:8351

Sequences

>Probe|12831544|PRIMERF Forward PCR primer (outermost) (22b)
ACATGAAGGTCTACCAGTAGCC
>Probe|12831544|PRIMERR Reverse PCR primer (outermost) (18b)
AGTGAGATCCTTCACTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmD7S672

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID8351
Probe Cross-refcontext specific help for: Probe Cross-refGDB:307724
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center