Display Settings:

Format

Send to:

Choose Destination
Pr012831107

STS probe D19S1122 for exosome component 3 (EXOSC3) and 3 more genes

Synopsis

Field NameValues
NameD19S1122
AliasesRH8807; SHGC-14824
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEXOSC3; EXOSC3; TRMT10B; EXOSC3
UniSTS IDUniSTS:83109

Sequences

>Probe|12831107|PRIMERF Forward PCR primer (outermost) (22b)
TTTTGCAATGATTTTCTCTCCC
>Probe|12831107|PRIMERR Reverse PCR primer (outermost) (21b)
ATGGGTTTTTTCAGGTGAACC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G391633 cr10000SHGC-14824
Homo sapiensradiation hybridGeneMap99-G391680 cr10000SHGC-14824
Homo sapienslinkageRutgers Map9 cmD19S1122
Homo sapiensradiation hybridNCBI RH9540.6 crSHGC-14824

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID83109
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737295; GDB:738409
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center