Display Settings:

Format

Send to:

Choose Destination
Pr012830913

STS probe RH46067 for zinc finger protein 33B (ZNF33B) and 2 more genes

Synopsis

Field NameValues
NameRH46067
AliasstSG21911
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100596514; ZNF33B; ZNF33B
UniSTS IDUniSTS:82933

Sequences

>Probe|12830913|PRIMERF Forward PCR primer (outermost) (22b)
TTTTCCAAAGTGGAAGCTTAGA
>Probe|12830913|PRIMERR Reverse PCR primer (outermost) (18b)
GAATCAAGCTGGCATGGG

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB410257.51 cr3000stSG21911
Homo sapienslinkageRutgers Map10 cmRH46067

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID82933
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center