Display Settings:

Format

Send to:

Choose Destination
Pr012830860

STS probe D7S2468 for ubinuclein 2 (UBN2) and 3 more genes

Synopsis

Field NameValues
NameD7S2468
AliasesA349YG5; AFMA349YG5; AFMa349yg5; HSA349YG5; RH31030; SHGC-20458; W3170
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesUBN2; UBN2; UBN2; UBN2
UniSTS IDUniSTS:82886

Sequences

>Probe|12830860|PRIMERF Forward PCR primer (outermost) (18b)
TTTTCACAAGAGGCCACC
>Probe|12830860|PRIMERR Reverse PCR primer (outermost) (20b)
TCTAGCGCACCTTACCAATG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

6.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G377092 cr10000SHGC-20458
Homo sapiensradiation hybridGeneMap99-G377593 cr10000AFMa349yg5
Homo sapienslinkageRutgers Map7 cmD7S2468
Homo sapienslinkageMarshfield7148.11 cmAFMa349yg5
Homo sapienslinkagedeCODE7147.65 cmD7S2468
Homo sapienslinkageGenethon7150.3 cmAFMa349yg5
Homo sapiensradiation hybridNCBI RH71290.9 crAFMa349yg5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID82886
Probe Cross-refcontext specific help for: Probe Cross-refGDB:608997
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center