Display Settings:

Format

Send to:

Choose Destination
Pr012830543

STS probe RH44574 for ankyrin repeat and death domain containing 1A (ANKDD1A) and 3 more genes

Synopsis

Field NameValues
NameRH44574
AliasstSG8390
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesANKDD1A; ANKDD1A; ANKDD1A; ANKDD1A
UniSTS IDUniSTS:82598

Sequences

>Probe|12830543|PRIMERF Forward PCR primer (outermost) (22b)
TTTGTGACTTTTCCATATCCCC
>Probe|12830543|PRIMERR Reverse PCR primer (outermost) (20b)
GGAGGGGTACACAAGGGTTT

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415219.65 cr3000stSG8390
Homo sapienslinkageRutgers Map15 cmRH44574
Homo sapiensradiation hybridNCBI RH15372.8 crstSG8390

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID82598
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center