Display Settings:

Format

Send to:

Choose Destination
Pr012830156

STS probe SHGC-10595 for cadherin 11 (CDH11) and 1 more gene

Synopsis

Field NameValues
NameSHGC-10595
AliasRH29177
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCDH11; CDH11
UniSTS IDUniSTS:82243

Sequences

>Probe|12830156|PRIMERF Forward PCR primer (outermost) (23b)
TTTGATTTTTTTTCTTCTCAGCG
>Probe|12830156|PRIMERR Reverse PCR primer (outermost) (23b)
AGTTTCTTTTTGCATTCTCCTCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3162371 cr10000SHGC-10595
Homo sapienslinkageRutgers Map16 cmSHGC-10595
Homo sapiensradiation hybridNCBI RH16508.6 crSHGC-10595

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID82243
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center