Display Settings:

Format

Send to:

Choose Destination
Pr012830032

STS probe D5S658 for protocadherin alpha 9 (PCDHA9) and 19 more genes

Synopsis

Field NameValues
NameD5S658
Aliases308ZA9; AFM308za9; HS308ZA9; RH42536; RH60025; RH6372
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Homo sapiens
Target genesPCDHA5; LOC100607821; PCDHA@; PCDHACT; PCDHAC2; PCDHAC1; PCDHA13; PCDHA12; PCDHA11; PCDHA10; PCDHA8; PCDHA7; PCDHA6; PCDHA5More
UniSTS IDUniSTS:82129

Sequences

>Probe|12830032|PRIMERF Forward PCR primer (outermost) (25b)
TTTGAAGGGCACTACGAAGATCCTC
>Probe|12830032|PRIMERR Reverse PCR primer (outermost) (24b)
ATTCTCTATTGGAGCCAAGCCAAG

References

1.

A rhesus macaque radiation hybrid map and comparative analysis with the human genome.

Murphy WJ, Agarwala R, Schäffer AA, Stephens R, Smith C Jr, Crumpler NJ, David VA, O'Brien SJ.

Genomics. 2005 Oct;86(4):383-95.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 5 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

5.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S658
Macaca mulattaradiation hybridRH6265 crD5S658
Homo sapienslinkageMarshfield5142.92 cmAFM308za9
Homo sapienslinkageGenethon5142.6 cmAFM308za9
Homo sapiensradiation hybridNCBI RH5889.1 crAFM308za9
Homo sapiensradiation hybridWhitehead-RH5441.7 cr3000D5S658

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID82129
Probe Cross-refcontext specific help for: Probe Cross-refGDB:200268
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center