Display Settings:

Format

Send to:

Choose Destination
Pr012829832

STS probe DXS7759 for phosphate regulating endopeptidase homolog X-linked (PHEX) and 4 more genes

Synopsis

Field NameValues
NameDXS7759
AliasHUMSWX1905
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPHEX; PHEX; PHEX; PHEX; PHEX
UniSTS IDUniSTS:81948

Sequences

>Probe|12829832|PRIMERF Forward PCR primer (outermost) (26b)
TTTCTCTGAATTAGTGTTAGGTATGG
>Probe|12829832|PRIMERR Reverse PCR primer (outermost) (26b)
TGCATTAATCAAATTCTGGGCAACTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7759

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID81948
Probe Cross-refcontext specific help for: Probe Cross-refGDB:600556
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center