Display Settings:

Format

Send to:

Choose Destination
Pr012828793

STS probe D1S2787 for syntaxin 12 (STX12) and 2 more genes

Synopsis

Field NameValues
NameD1S2787
AliasesAFMb350zb1; B350ZB1; HSB350ZB1; RH31559; RH49375; SHGC-21271; W3276; stSG14464
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSTX12; STX12; STX12
UniSTS IDUniSTS:80998

Sequences

>Probe|12828793|PRIMERF Forward PCR primer (outermost) (20b)
TTTAACCCTGGAAGGTTGAG
>Probe|12828793|PRIMERR Reverse PCR primer (outermost) (22b)
ACAGGACAATGCTGTCAGTATG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG112629 cr50000SHGC-21271
Homo sapienslinkageRutgers Map1 cmD1S2787
Homo sapienslinkageMarshfield156.48 cmAFMb350zb1
Homo sapienslinkageGenethon157.2 cmAFMb350zb1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID80998
Probe Cross-refcontext specific help for: Probe Cross-refGDB:611712
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center