Display Settings:

Format

Send to:

Choose Destination
Pr012828599

STS probe D12S1434 for PTPRF interacting protein alpha 2 (PPFIA2)

Synopsis

Field NameValues
NameD12S1434
AliasesHALD50C6; MR5108; RH3225; RH52423; WI-3674; WIAF-1088
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePPFIA2
UniSTS IDUniSTS:8082

Sequences

>Probe|12828599|PRIMERF Forward PCR primer (outermost) (20b)
ACAGTACACATGGCCCCATT
>Probe|12828599|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGGCTGTGATTGGCAGTA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridNCBI RH12573.6 crWI-3674
Homo sapiensradiation hybridWhitehead-RH12426.2 cr3000WI-3674

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588880
UniSTS IDcontext specific help for: UniSTS ID8082
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center