Display Settings:

Format

Send to:

Choose Destination
Pr012828423

Homo sapiens STS probe D8S2088

Synopsis

Field NameValues
NameD8S2088
AliasesRH29625; SHGC-14104
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:80660

Sequences

>Probe|12828423|PRIMERF Forward PCR primer (outermost) (23b)
TTGTGACTCTGATATGCACATCC
>Probe|12828423|PRIMERR Reverse PCR primer (outermost) (21b)
TGTGTTTGGGTGTGAGATTCA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G381906 cr10000SHGC-14104
Homo sapienslinkageRutgers Map8 cmD8S2088

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID80660
Probe Cross-refcontext specific help for: Probe Cross-refGDB:739403
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center