Display Settings:

Format

Send to:

Choose Destination
Pr012826744

Macaca mulatta and Homo sapiens STS probe D22S685

Synopsis

Field NameValues
NameD22S685
AliasesCHLC.32030; CHLC.GATA6F05; CHLC.GATA6F05.32030; CHLC.GATA6F05.P6392; GATA-D22S685; GATA6F05; RH27821; RH28258; RH30338; RH5251; RH57643; SHGC-17773; stSG5893
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Homo sapiens
UniSTS IDUniSTS:79136

Sequences

>Probe|12826744|PRIMERF Forward PCR primer (outermost) (20b)
TTCTTAGTGGGGAAGGGATC
>Probe|12826744|PRIMERR Reverse PCR primer (outermost) (24b)
TGAGTTTGATGTTTTTGATAGACA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A rhesus macaque radiation hybrid map and comparative analysis with the human genome.

Murphy WJ, Agarwala R, Schäffer AA, Stephens R, Smith C Jr, Crumpler NJ, David VA, O'Brien SJ.

Genomics. 2005 Oct;86(4):383-95.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

6.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G322848 cr10000SHGC-17773
Homo sapienslinkageRutgers Map22 cmD22S685
Macaca mulattaradiation hybridRH1030.8 crD22S685
Homo sapienslinkageMarshfield2232.39 cmGATA6F05
Homo sapienslinkagedeCODE2238.79 cmD22S685
Homo sapiensradiation hybridNCBI RH22143.7 crSHGC-17773
Homo sapiensradiation hybridWhitehead-RH22107.5 cr3000CHLC.GATA6F05

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID79136
Probe Cross-refcontext specific help for: Probe Cross-refGDB:364343
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center