Display Settings:

Format

Send to:

Choose Destination
Pr012826528

STS probe D10S1195 for protein kinase, cGMP-dependent, type I (PRKG1) and 2 more genes

Synopsis

Field NameValues
NameD10S1195
AliasesMH529; RH34677; SHGC-6416; WI-844
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPRKG1; PRKG1; PRKG1
UniSTS IDUniSTS:78939

Sequences

>Probe|12826528|PRIMERF Forward PCR primer (outermost) (24b)
TTCTGAAAGTAAATGACAATGTCC
>Probe|12826528|PRIMERR Reverse PCR primer (outermost) (20b)
AAGATGCAAGAAATGGGAGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3102558 cr10000SHGC-6416
Homo sapienslinkageRutgers Map10 cmD10S1195
Homo sapiensradiation hybridNCBI RH10635.9 crSHGC-6416

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID78939
Probe Cross-refcontext specific help for: Probe Cross-refGDB:355032
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center