Display Settings:

Format

Send to:

Choose Destination
Pr012826224

STS probe D14S757 for neuronal PAS domain protein 3 (NPAS3) and 4 more genes

Synopsis

Field NameValues
NameD14S757
AliasesMR7597; WI-4526
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNPAS3; NPAS3; NPAS3; NPAS3; NPAS3
UniSTS IDUniSTS:78659

Sequences

>Probe|12826224|PRIMERF Forward PCR primer (outermost) (21b)
TTCGCTTTGTTTTCATCAAGG
>Probe|12826224|PRIMERR Reverse PCR primer (outermost) (25b)
AACTCATGATTCCTTGTAGAAGTCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmD14S757

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID78659
Probe Cross-refcontext specific help for: Probe Cross-refGDB:458343
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center