Display Settings:

Format

Send to:

Choose Destination
Pr012825927

STS probe D20S781 for ERCC excision repair 6 like 2 (ERCC6L2) and 1 more gene

Synopsis

Field NameValues
NameD20S781
AliasesRH34380; SHGC-5727
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesERCC6L2; RSF1
UniSTS IDUniSTS:7839

Sequences

>Probe|12825927|PRIMERF Forward PCR primer (outermost) (20b)
ACAGCAAGACTCCATCTCAA
>Probe|12825927|PRIMERR Reverse PCR primer (outermost) (20b)
CTCACCAGTTGATGGACATT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3202547 cr10000SHGC-5727
Homo sapiensradiation hybridNCBI RH20529.9 crSHGC-5727

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:598084
UniSTS IDcontext specific help for: UniSTS ID7839
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center