Display Settings:

Format

Send to:

Choose Destination
Pr012825904

STS probe SHGC-3342 for kinesin family member 13B (KIF13B)

Synopsis

Field NameValues
NameSHGC-3342
AliasRH32771
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneKIF13B
UniSTS IDUniSTS:78369

Sequences

>Probe|12825904|PRIMERF Forward PCR primer (outermost) (25b)
TTCCCAGCCTTCATTTTTCTTAAAC
>Probe|12825904|PRIMERR Reverse PCR primer (outermost) (26b)
TTAACTCCAGAACAAGTGAAATACAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G381305 cr10000SHGC-3342
Homo sapienslinkageRutgers Map8 cmSHGC-3342
Homo sapiensradiation hybridNCBI RH8388.7 crSHGC-3342

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID78369
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center