Display Settings:

Format

Send to:

Choose Destination
Pr012825687

STS probe D3S1614 for EGF like and EMI domain containing 1, pseudogene (EGFEM1P)

Synopsis

Field NameValues
NameD3S1614
Aliases345TH5; AFM345th5; HS345TH5; RH42595
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneEGFEM1P
UniSTS IDUniSTS:78172

Sequences

>Probe|12825687|PRIMERF Forward PCR primer (outermost) (24b)
TTCCAAGATATGTGTGACTTACAG
>Probe|12825687|PRIMERR Reverse PCR primer (outermost) (22b)
GATATTTAAGCCTTGACCCTGA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield3177.75 cmAFM345th5
Homo sapienslinkagedeCODE3169.98 cmD3S1614
Homo sapienslinkageGenethon3183.1 cmAFM345th5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:200058
UniSTS IDcontext specific help for: UniSTS ID78172
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center