Display Settings:

Format

Send to:

Choose Destination
Pr012825388

STS probe D12S1068 for MGAT4 family member C (MGAT4C) and 3 more genes

Synopsis

Field NameValues
NameD12S1068
AliasesCHLC.GATA68D10; CHLC.GATA68D10.P17791
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMGAT4C; MGAT4C; MGAT4C; MGAT4C
UniSTS IDUniSTS:77901

Sequences

>Probe|12825388|PRIMERF Forward PCR primer (outermost) (21b)
TTCAGCATGTTTTCTACATGC
>Probe|12825388|PRIMERR Reverse PCR primer (outermost) (22b)
TTATATGTGGCATTCTGTCACC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S1068

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77901
Probe Cross-refcontext specific help for: Probe Cross-refGDB:685458
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center