Display Settings:

Format

Send to:

Choose Destination
Pr012825228

STS probe D11S4651 for proteasome subunit alpha 1 (PSMA1) and 5 more genes

Synopsis

Field NameValues
NameD11S4651
AliasesRH8772; SHGC-13819
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100404263; LOC100582660; PSMA1; PSMA1; PSMA1; PSMA1
UniSTS IDUniSTS:77758

Sequences

>Probe|12825228|PRIMERF Forward PCR primer (outermost) (24b)
TTCACAGTTGTCTTTAAAACCACA
>Probe|12825228|PRIMERR Reverse PCR primer (outermost) (20b)
TCCAAGCAACCTCACTGAAA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G311509 cr10000SHGC-13819
Homo sapiensradiation hybridGeneMap99-G311509 cr10000SHGC-13819
Homo sapienslinkageRutgers Map11 cmD11S4651
Homo sapiensradiation hybridNCBI RH11105.7 crSHGC-13819

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77758
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740471; GDB:741783
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center