Display Settings:

Format

Send to:

Choose Destination
Pr012825132

STS probe G11813 for small integral membrane protein 29 (SMIM29) and 1 more gene

Synopsis

Field NameValues
NameG11813
AliasesEST102760; WI-8655
TypeSTS
Application
Source organism
Source sequence
Target genesSMIM29; HMGA1
UniSTS IDUniSTS:77671

Sequences

>Probe|12825132|PRIMERF Forward PCR primer (outermost) (25b)
TTCAAGTAACTGCAAATAGGAAACC
>Probe|12825132|PRIMERR Reverse PCR primer (outermost) (20b)
ATAAAGGGTGTAGGGGCCAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77671
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center