Display Settings:

Format

Send to:

Choose Destination
Pr012824850

STS probe SHGC-30672 for sperm associated antigen 6 (SPAG6) and 3 more genes

Synopsis

Field NameValues
NameSHGC-30672
AliasRH14807
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSPAG6; SPAG6; SPAG6; SPAG6
UniSTS IDUniSTS:77410

Sequences

>Probe|12824850|PRIMERF Forward PCR primer (outermost) (22b)
TTATTGAAACCCTCTTTCACCC
>Probe|12824850|PRIMERR Reverse PCR primer (outermost) (22b)
TTCCCAAGTTTCAAAAGTCACA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G310967 cr10000SHGC-30672
Homo sapiensradiation hybridGeneMap99-G310967 cr10000SHGC-30672
Homo sapienslinkageRutgers Map10 cmSHGC-30672

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77410
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center