Display Settings:

Format

Send to:

Choose Destination
Pr012824673

STS probe G19699 for 60S ribosomal protein L15-like (LOC100580373) and 3 more genes

Synopsis

Field NameValues
NameG19699
AliasA001V42
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100580373; LOC100585784; LOC100589480; RPL15
UniSTS IDUniSTS:77249

Sequences

>Probe|12824673|PRIMERF Forward PCR primer (outermost) (23b)
TTATGAACTTGCTATGAGTACTT
>Probe|12824673|PRIMERR Reverse PCR primer (outermost) (23b)
GAGTGTAAAGAAAATGTAGACAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID77249
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center