Display Settings:

Format

Send to:

Choose Destination
Pr012823840

STS probe STS-AA024836 for branched chain keto acid dehydrogenase E1, alpha polypeptide (BCKDHA) and 4 more genes

Synopsis

Field NameValues
NameSTS-AA024836
AliasesRH75401; sts-AA024836
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTMEM91; TMEM91; TMEM91; BCKDHA; TMEM91
UniSTS IDUniSTS:76492

Sequences

>Probe|12823840|PRIMERF Forward PCR primer (outermost) (20b)
TTAATCTCAGGTTGCTGCCG
>Probe|12823840|PRIMERR Reverse PCR primer (outermost) (18b)
GAGACCCGCCCTAGTTGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419238.63 cr3000sts-AA024836
Homo sapienslinkageRutgers Map19 cmSTS-AA024836
Homo sapiensradiation hybridNCBI RH19423.5 crsts-AA024836

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID76492
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center