Display Settings:

Format

Send to:

Choose Destination
Pr012822360

Homo sapiens STS probe D17S1308

Synopsis

Field NameValues
NameD17S1308
AliasesCHLC.GTAT1A05; CHLC.GTAT1A05.P9180; GTAT-D17S1308; GTAT1A05; RH28212; RH55172
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:75146

Sequences

>Probe|12822360|PRIMERF Forward PCR primer (outermost) (25b)
TGTGAAACTTTGTCATCACTATACC
>Probe|12822360|PRIMERR Reverse PCR primer (outermost) (21b)
TTGGTGACAAAGAAAGTCTCC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmD17S1308
Homo sapienslinkageMarshfield170.63 cmGTAT1A05
Homo sapiensradiation hybridNCBI RH1732.2 crCHLC.GTAT1A05
Homo sapiensradiation hybridWhitehead-RH1724.7 cr3000CHLC.GTAT1A05

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID75146
Probe Cross-refcontext specific help for: Probe Cross-refGDB:686229
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center