Display Settings:

Format

Send to:

Choose Destination
Pr012822091

STS probe D22S1555 for TIMP metallopeptidase inhibitor 3 (TIMP3) and 14 more genes

Synopsis

Field NameValues
NameD22S1555
AliasesRH8786; SHGC-13927
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSYN3; LOC100146694; SYN3; SYN3; SYN3; TIMP3; SYN3; TIMP3; TIMP3; SYN3; TIMP3; TIMP3; SYN3; TIMP3More
UniSTS IDUniSTS:74903

Sequences

>Probe|12822091|PRIMERF Forward PCR primer (outermost) (24b)
TGTCATGATTTTCTTCAAACAAGC
>Probe|12822091|PRIMERR Reverse PCR primer (outermost) (20b)
GCATATACCCACATGGGGAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G322782 cr10000SHGC-13927
Homo sapiensradiation hybridGeneMap99-G322782 cr10000SHGC-13927
Homo sapienslinkageRutgers Map22 cmD22S1555
Homo sapiensradiation hybridNCBI RH22140 crSHGC-13927

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID74903
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737564; GDB:738679
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center