Display Settings:

Format

Send to:

Choose Destination
Pr012821921

STS probe G34338 for tec protein tyrosine kinase (TEC) and 1 more gene

Synopsis

Field NameValues
NameG34338
AliasSHGC-51321
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTEC; TEC
UniSTS IDUniSTS:74750

Sequences

>Probe|12821921|PRIMERF Forward PCR primer (outermost) (22b)
TGTATGCTGCTGAATTTATGGG
>Probe|12821921|PRIMERR Reverse PCR primer (outermost) (25b)
GATGCATGGAAAAATGATTATAAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmG34338

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID74750
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center