Display Settings:

Format

Send to:

Choose Destination
Pr012821574

STS probe G17556 for CUGBP Elav-like family member 1 (CELF1) and 3 more genes

Synopsis

Field NameValues
NameG17556
AliasSHGC-2885
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCELF1; CELF1; CELF1; CELF1
UniSTS IDUniSTS:74435

Sequences

>Probe|12821574|PRIMERF Forward PCR primer (outermost) (24b)
TGTAAAATATGGTACAGAGCCAGG
>Probe|12821574|PRIMERR Reverse PCR primer (outermost) (25b)
GAAATCATACCAATAAACAGCTTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmG17556

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID74435
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center