Display Settings:

Format

Send to:

Choose Destination
Pr012820363

STS probe D10S215 for 3'-phosphoadenosine 5'-phosphosulfate synthase 2 (PAPSS2) and 4 more genes

Synopsis

Field NameValues
NameD10S215
Aliases205WD12; AFM205WD12; AFM205wd12
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPAPSS2; PAPSS2; PAPSS2; PAPSS2; PAPSS2
UniSTS IDUniSTS:73335

Sequences

>Probe|12820363|PRIMERF Forward PCR primer (outermost) (17b)
TGGCATCATTCTGGGGA
>Probe|12820363|PRIMERR Reverse PCR primer (outermost) (22b)
GCTTTACGTTTCTTCACATGGT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmD10S215
Homo sapienslinkageMarshfield10107.72 cmAFM205wd12

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID73335
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188322
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center