Display Settings:

Format

Send to:

Choose Destination
Pr012819856

STS probe D12S1418 for phenylalanine hydroxylase (PAH) and 2 more genes

Synopsis

Field NameValues
NameD12S1418
AliasesRH13950; SHGC-12465; UTR-02951; WI-7209
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPAH; PAH; PAH
UniSTS IDUniSTS:72878

Sequences

>Probe|12819856|PRIMERF Forward PCR primer (outermost) (21b)
TGGACAGAATGTGGTCTGTCA
>Probe|12819856|PRIMERR Reverse PCR primer (outermost) (24b)
TTCTCTGCAAAGCATATATGAAGC

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G3124748 cr10000SHGC-12465
Homo sapienslinkageRutgers Map12 cmD12S1418

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID72878
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588367
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center