Display Settings:

Format

Send to:

Choose Destination
Pr012819378

STS probe G09565 for peroxisomal biogenesis factor 5 like (PEX5L) and 3 more genes

Synopsis

Field NameValues
NameG09565
AliasesCHLC.GCT8B03; CHLC.GCT8B03.P11188
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPEX5L; LOC100435611; PEX5L; PEX5L
UniSTS IDUniSTS:72442

Sequences

>Probe|12819378|PRIMERF Forward PCR primer (outermost) (20b)
TGCTGCCTTCACAGTACAAA
>Probe|12819378|PRIMERR Reverse PCR primer (outermost) (20b)
CCTGTAACATGGGGTTTCTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmG09565

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID72442
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center