Display Settings:

Format

Send to:

Choose Destination
Pr012819055

STS probe SHGC-36745 for RAB18, member RAS oncogene family (RAB18) and 2 more genes

Synopsis

Field NameValues
NameSHGC-36745
AliasRH38062
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRAB18; RAB18; RAB18
UniSTS IDUniSTS:7215

Sequences

>Probe|12819055|PRIMERF Forward PCR primer (outermost) (25b)
ACAAGTTGGTTTTGATGAACTACTG
>Probe|12819055|PRIMERR Reverse PCR primer (outermost) (24b)
ATATTGCTTCCAGATTCTGATGTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3101380 cr10000SHGC-36745
Homo sapiensradiation hybridGeneMap99-G3101380 cr10000SHGC-36745
Homo sapienslinkageRutgers Map10 cmSHGC-36745
Homo sapiensradiation hybridNCBI RH10450.5 crSHGC-36745

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID7215
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center