Display Settings:

Format

Send to:

Choose Destination
Pr012818719

STS probe D20S201 for phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 (PIP4P2) and 2 more genes

Synopsis

Field NameValues
NameD20S201
AliasesCHLC.474; CHLC.GATA8B01; CHLC.GATA8B01.474; CHLC.GATA8B01.P6524; GATA-D20S201; GATA-P6524; GATA8B01; RH30512; RH34119; RH62147; RH7218; SHGC-18045; SHGC-4571
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPIP4P2; PIP4P2; PIP4P2
UniSTS IDUniSTS:71847

Sequences

>Probe|12818719|PRIMERF Forward PCR primer (outermost) (20b)
TGCCATAGCAGAGAGGGATA
>Probe|12818719|PRIMERR Reverse PCR primer (outermost) (21b)
ATGGATAAATTGAGTTTCCCC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield8103.69 cmGATA8B01
Homo sapiensradiation hybridWhitehead-RH8545 cr3000CHLC.GATA8B01.474

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:208259
UniSTS IDcontext specific help for: UniSTS ID71847
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center