Display Settings:

Format

Send to:

Choose Destination
Pr012817800

STS probe D5S408 for CCR4-NOT transcription complex subunit 6 (CNOT6) and 2 more genes

Synopsis

Field NameValues
NameD5S408
Aliases164XB8; AFM164xb8; HS164XB8; RH15133; RH28054; RH59999; RH6354
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100460246; CNOT6; CNOT6
UniSTS IDUniSTS:7101

Sequences

>Probe|12817800|PRIMERF Forward PCR primer (outermost) (20b)
ACAACTTCCAACCCTGAGAT
>Probe|12817800|PRIMERR Reverse PCR primer (outermost) (20b)
ACTGTGCCTAGCCTTCATTT

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 4 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S408
Homo sapienslinkageMarshfield5195.49 cmAFM164xb8
Homo sapienslinkagedeCODE5205.05 cmD5S408
Homo sapienslinkageGenethon5195.8 cmAFM164xb8
Homo sapiensradiation hybridWhitehead-RH5547.2 cr3000D5S408

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID7101
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188137
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center