Display Settings:

Format

Send to:

Choose Destination
Pr012817792

STS probe D12S333 for transmembrane and tetratricopeptide repeat containing 1 (TMTC1) and 3 more genes

Synopsis

Field NameValues
NameD12S333
Aliases265ZB1; AFM265zb1; HS265ZB1; RH3270; RH52983
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTMTC1; TMTC1; TMTC1; TMTC1
UniSTS IDUniSTS:71002

Sequences

>Probe|12817792|PRIMERF Forward PCR primer (outermost) (16b)
TGATTGCCCCCAACAG
>Probe|12817792|PRIMERR Reverse PCR primer (outermost) (20b)
GGCTTGAGGATCATAGCAAA

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageMarshfield1251.99 cmAFM265zb1
Homo sapienslinkageGenethon1253.3 cmAFM265zb1
Homo sapiensradiation hybridWhitehead-RH12186.5 cr3000D12S333

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:199611
UniSTS IDcontext specific help for: UniSTS ID71002
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center